Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ-ZFR | |||
Gene | ZFR | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
DBLink | Link to database | PMID | 29361817 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Gastric Cancer tissues and adjacent tissue samples were collected from 48 GC patients and Human gastric epithelial cell line GES-1 and human GC cell lines AGS, AZ521, and HGC-27 |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward AACCACCACAGATTCACTAT ReverseAACCACCACAGATTCACTAT | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Liu, T, Liu, S, Xu, Y, Shu, R, Wang, F, Chen, C, Zeng, Y, Luo, H (2018). Circular RNA-ZFR Inhibited Cell Proliferation and Promoted Apoptosis in Gastric Cancer by Sponging miR-130a/miR-107 and Modulating PTEN. Cancer Res Treat, 50, 4:1396-1417. |